G-protein coupled-receptor 65 5´UTR gene polymorphism in the pathogenesis of systemic lupus erythematosus

Document Type: Original Article

Authors

1 Department of Biology, Islamic Azad University, Arsanjan Branch, Arsanjan, Iran

2 Department of Rheumatology, Loghman e Hakim Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran

3 Department of Internal Medicine, Faculty of Medicine, Hormozgan University of Medical Sciences, Bandar Abbas, Iran

Abstract

Systemic lupus erythematosus (SLE) is a complex autoimmune disease with unknown etiology. G-protein-coupled receptor 65 (GPR65) candidates as an SLE-locus for functioning in T cell receptor-mediated self-reactive T cell death in the thymus. This is also involved in anti-inflammatory actions and apoptosis as remarkable features of autoimmune diseases. This study investigated the relationship between the rs10139328 polymorphism at the 5´UTR of a GPR65 gene and SLE. This case-control study consisted of 102 SLE patients (98 females, 4 males) and 118 age- and gender-matched healthy controls (113 females, 5 males). Genotyping of the rs10139328 polymorphism was determined using an amplification refractory mutation system-polymerase chain reaction (ARMS-PCR). Data was analyzed using SPSS software. The Pearson chi-square was the test of choice for assessing the association between the rs10139328 polymorphism and SLE. The probable influences of sunlight and family history on SLE were evaluated by performing logistic regression. Except for one heterozygote subject among the control group, the study population was homozygote for the selected polymorphism. No statistical difference was seen in genotype distribution between the cases and the controls (P> 0.05). Statistical analysis revealed that sun exposure directly increased SLE susceptibility (P < 0.001). Having a family history of SLE increased the risk of disease occurrence by more than two times (OR = 2.38, 95% CI: 1.28 - 4.41, P= 0.006). The results of the current study do not support the importance of the studied polymorphism in a GPR65 gene in the pathogenesis of SLE among southwestern Iranian patients.

Keywords

Main Subjects


Introduction___________________________

Systemic lupus erythematosus (SLE) is a multisystemic autoimmune inflammatory disorder with worldwide distribution [1]. It affects both men and women, although it appears that women of childbearing age are more susceptible to this disorder [2]. SLE is characterized by various tissue injuries, e.g., skin, lung, kidney, heart, and CNS, due to the deposition of immune complexes [3]. Hyperactivation of self-reactive B cells and dysfunction of T lymphocytes are the most probable causes of insufficiency in immune complex clearance [4-6].

T cell death-associated gene 8 (TDAG8 or GPR65, gene ID: 8477), which belongs to the G-protein-coupled receptor (GPR) superfamily, is known as a novel regulator of T cell function, T cell and B cell behavior, and autoimmune inflammation [7, 8]. This G-protein-coupled receptor actively participates in the apoptosis pathway by activating the caspase-9, -8, -3, which is a common phenomenon in autoimmune diseases including systemic lupus erythematosus (SLE) [9]. T cell receptor (TCR) is a member of a complex of proteins acting in the negative selection of self-reactive immature T cells in thymus. GPR65 is exclusively expressed in the spleen, thymus, lymph nodes, and lymphocytes and upregulated during TCR-mediated cell death [10]. Mandel et al. supposed that the down-regulation of this gene may lead to the prolonged survival of self-reactive T lymphocytes, a characteristic of autoimmune diseases [11].

The functional role of the GPR65 protein in the regulation of pro-inflammatory cytokines, production of antibodies by B cells, and modulation of the function of T cells as the main deregulated mechanisms in the pathogenesis of SLE persuaded the authors to investigate the relationship between the probable functional polymorphism rs10139328 (C/T) in the 5′UTR element of the GPR65 gene and the risk of SLE among patients from southwestern Iranian population.

Materials and Methods__________________

Study population

A total of 102 SLE patients (mean age 32.36±8.56 years) who were treated at the Rheumatology Clinic of Khatam-al-Anbia Hospital, Bandar Abbas, Iran were enrolled in this case-control study. One hundred eighteen healthy volunteers (mean age 32.55±9.46 years) from the same region were selected as a control group. Subjects were matched for gender and age (±5). All participants of the control group stated that they had no history of rheumatoid arthritis, SLE, or other autoimmune diseases. Pregnant women were excluded from the study (in both case and control groups). Diagnoses were performed according to the American College of Rheumatology classification criteria (ACR). All clinical procedures were approved by the local Ethics Committee of Islamic Azad University, Arsanjan Branch, and all participants completed informed consent forms prior to their inclusion in the study.

To investigate the role of sunlight in the pathogenesis of SLE, the study subjects were divided into two groups according to their workplace: Outdoors (farmers, drivers, policemen, etc.) and Indoors (housewives, teachers, etc.).

Genotyping

Five ml of blood was collected in EDTA tubes from cases and controls and stored at -20 °C until DNA extraction. DNA was extracted from whole blood samples using the standard "salting out" method [12], and the rs10139328 single nucleotide polymorphism (SNP) of the candidate gene was genotyped using the touchdown amplification refractory mutation system-polymerase chain reaction (touchdown ARMS-PCR) technique. In this method, two PCR reactions were set for each individual; each reaction contained one allele specific (in this case the C allele or T allele) primer and two outer primers (non-allele specific). Primers were designed using Primer 1 software [13]. The detailed information of the primers are shown in Table 1. PCR was performed using a commercially available PCR premix (YTA, Iran), and the manufacturer’s instructions were followed. An optimized protocol which uses three different annealing temperatures was performed as follows: initial denaturation step of 95 °C for 5 min, 10 cycles of 94 °C for 40 s, 65 °C for 40 s, and 72 °C for 40 s, 15 cycles of 94 °C for 40 s, 55 °C for 40 s, and 72 °C for 40 s, 10 cycles of 94 °C for 40 s, 52 °C for 40 s, and 72 °C for 40 s, followed by a final extension cycle at 72 °C for 3 min, and then cooled to 4 °C. The amplified products were separated by electrophoresis on a 2% agarose gel containing 0.5 mg/ml DNA safe stain dye.

Statistical analysis

Statistical analysis of the data was performed using SPSS version 19.0 software. Continuous variables were reported as mean±SD, and the categorical variables were presented using frequency counts.Deviation from Hardy-Weinberg equilibrium was evaluated by performing the chi-square test. Binary logistic regression was used to assess the influence of some risk factors (family history of SLE and sun exposure) on the risk of SLE disease using a 95% confidence interval (95%CI) and odds ratio (OR). The associations between genotype and allele frequencies were investigated by computing the Pearson chi-square test. P<0.05 was considered statistically significant.

Results_______________________________

Baseline characteristics of the study samples are described in Table 2. Most patients (95.8%) and controls (96.1%) were female. Table 3 shows the genotype and allele distributions of the rs10139328 polymorphism in SLE patients and healthy controls. The control (χ2 = 0.012, df = 1, p ≥ 0.05) population was in Hardy-Weinberg equilibrium for the genotype frequencies of the studied SNP. The Pearson chi-square test showed that there was no significant association between the rs10139328 polymorphism and SLE (Table 3). Except for one control subject who carried the mutant allele T in a heterozygous manner, the other subjects were homozygous for wild-type allele C (Table 3). About 39.2% and 11.9% of patients and controls worked outdoors, respectively. Exposure to sunlight significantly differed between cases and controls (OR= 4.79, 95% CI: 2.41 - 9.50, P< 0.001). The frequency of a positive family history of SLE was significantly higher in cases (35.5%) compared to controls (18.6%) and was statistically significant between patients and controls (OR = 2.38, 95% CI: 1.28 - 4.41, P= 0.006) (Table 4).

Discussion____________________________

SLE is a complex disorder involving the interaction of several genetic loci and environmental factors. Among these, the role of sunlight on the risk and severity of the disease has been confirmed by many investigators [14-16]. UV light exacerbates the manifestation of SLE. The present findings suggested that subjects with outdoor jobs were at higher risk of developing SLE. It may be suggested that UV light induces apoptosis, which promotes higher release of self-antigen and subsequently more production of auto-antibodies against them [17].

GPR65, a member of the G-protein-coupled receptor family, is important in the regulation of T cell and B cell behavior in the immune system [8]. The gene for GPR65 is located on the long arm of chromosome 14 (14q31-q32.1) with several single nucleotide polymorphisms (SNPs) distributed over the entire gene sequence [18]. Evidence indicated that GPR65 may have a role in activation-induced differentiation or T cell death [19]. In human SLE patients, peripheral blood mononuclear cells (PBMCs) expressed lower levels of GPR65 compared with those cells from multiple sclerosis (MS) patients [11]. A recent study on a mouse model of MS indicated that GPR65 deficiency exacerbating the disease [20]. Therefore, the present study hypothesized that GPR65 may be a protective factor against autoimmune diseases, and GPR65 polymorphisms may be closely associated with autoimmune diseases.

The role of GPR65 in autoimmune diseases has been investigated in numerous studies. Franke et al. reported the association of GPR65 with Crohn’s disease susceptibility [21]. In addition, Ke revealed the association of GPR65 rs8005161 polymorphism with type 2 diabetes (T2D) [22]. Furthermore, disturbance in the concentration of cytokines (including IL-6 and IL-10) is an obvious event in the SLE patients [23-25]. GPR65 is known as an upstream negative regulatory component of the mentioned cytokines [8]. Therefore, GPR65 seems to be one of the best candidate genes in the pathogenesis of SLE.

 

 

Table 1. SNP in GPR65 gene, its location, and the primer sequences

Gene

polymorphism

primer sequence 5′ to 3′

GPR65

rs10139328

C/T

5′UTR

Forward outer: CGCACACCCTTCTCATTG

Reverse outer: CAACCCCCTTTTTCTATATCTATG

Reverse inner (T): TTTTTTAATCTTATACTTACCCCTA

Reverse inner (C): TTTTTTAATCTTATACTTACCCCTG

 

Table 2. Baseline characteristics of the study samples

Characteristics

Controls

Cases

P value

Total

118

102

-

Mean age (year±SD)

32.55±9.46

32.36±8.56

0.87

Age range

13-59

13-59

-

Sex ratio (M/F)

5/113

4/98

 

 

Table 3. Genotype and allele frequencies of the rs10139328 polymorphism among SLE patients and healthy controls

rs10139328

Controls

n=118 (%)

Cases

n=102 (%)

OR (95%CI)

P*

Genotypes

CC

117 (99.2)

102 (100)

1.01 (0.99- 1.03)

0.35

CT

1 (0.8)

0 (0.0)

TT

0 (0.0)

0 (0.0)

Allele

C

235 (99.2)

204 (100)

1.00 (0.02- 50.39)

0.5

T

1 (0.8)

0 (0.0)

*Pearson Chi-square test

 

Table 4. Association between family history of SLE, work place, and SLE risk

Risk factor

Controls n=118

Cases n=102

OR

95% CI

P*

Family history

Yes

No

 

22 (18.6)

96 (81.4)

 

36 (35.3)

66 (64.7)

 

2.38

1

 

1.28-4.41

reference

 

0.006

-

Work place

Outdoor

Indoor

 

14 (11.9)

104 (88.1)

 

40 (39.2)

62 (60.8)

 

4.79

1

 

2.41-9.50

reference

 

<0.001

-

OR: Odd Ratio, CI: Confidence interval; *P≤0.05=significant

 

 

 

The present study investigated polymorphism rs10139328 at 5′UTR of the GPR65. Statistical analysis revealed that in both patient and control groups, the polymorphic-type homozygote TT frequency was zero. Wild-type CC genotype was also distributed evenly in both patient and control groups; thus, no statistically significant difference in the distribution frequencies of the CC genotype between the two groups was detected. In addition, the distribution frequency of the C allele was not significantly different between the two groups. This finding supported no association between the rs10139328 polymorphism and SLE in the southwestern Iranian population. Based on the results of previous studies, GPR65 was hypothesized to be a candidate gene involved in the pathogenesis of autoimmune diseases; however, to date, their exact association remains unclear. Thus, the present study investigated the correlation between GPR65 and SLE, which is a common autoimmune disease. In contrast to the authors’ hypothesis, no association between the selected polymorphism in the 5′UTR region of GPR65 and susceptibility to SLE was found among patients suffering from SLE in southwestern Iran.

Calling attention to the limitations of the study may be beneficial for the further molecular investigation of SLE. The main limitation of this study is its small sample size, especially when the study samples were stratified into indoor/outdoor or positive/negative family history groups. Another limitation is the way of considering sun exposure as a dichotomous variable (indoor vs. outdoor), not a continuous variable. It is recommended that future studies investigate the association in larger populations and participants from different geographical regions to confirm these findings.

Conflicts of interest

The author declares no conflicts of interest.

Acknowledgments

The authors express their special appreciation to Nosaibe Jaafari and Najmeh Noruzi (molecular genetics lab staff members) for their technical assistance. This work was supported by the Islamic Azad University, Arsanjan Branch.

  1. Jimenez S, Cervera R, Font J, Ingelmo M. The epidemiology of systemic lupus erythematosus. Clin Rev Allergy Immunol2003; 25(1): 3-12. doi: 10.1385/criai:25:1:3.
  2.  Putterman C, Caricchio R, Davidson A, Perlman H. Systemic lupus erythematosus. Clin Dev Immunol2012; 2012:437282. doi: 10.1155/2012/ 437282.
  3.  Moser KL, Kelly JA, Lessard CJ, Harley JB. Recent insights into the genetic basis of systemic lupus erythematosus. Genes and immunity2009; 10(5): 373-79. doi: 10.1038/gene.2009.39.
  4. Davidson A, Diamond B. Autoimmune diseases. N Engl J Med2001; 345(5): 340-50. doi: 10.1056/nejm200108023450506.
  5. Manson JJ, Rahman A. Systemic lupus erythematosus. Orphanet Journal of Rare Diseases2006; 1: 6-6. doi: 10.1186/1750-1172-1-6.
  6.  Rahimi S, Nasiri M, Arian nia S, Farrokh seresht R. Association of GADD45A Gene Polymorphism with Systemic Lupus Erythematosus Disease among Patients in South of Iran. Arak Medical University Journal2016; 19(9): 59-66.
  7. Ishii S, Kihara Y, Shimizu T. Identification of T cell death-associated gene 8 (TDAG8) as a novel acid sensing G-protein-coupled receptor. J Biol Chem2005; 280(10): 9083-7. doi: 10.1074/jbc.M407832200.
  8. Onozawa Y, Fujita Y, Kuwabara H, Nagasaki M, Komai T, Oda T. Activation of T cell death-associated gene 8 regulates the cytokine production of T cells and macrophages in vitro. Eur J Pharmacol2012; 683(1-3): 325-31. doi: 10.1016/j.ejphar.2012.03. 007.
  9. Tosa N, Murakami M, Jia WY, Yokoyama M, Masunaga T, Iwabuchi C. et al. Critical function of T cell death-associated gene 8 in glucocorticoid-induced thymocyte apoptosis. Int Immunol2003; 15(6): 741-9. doi: 10.1093/ intimm/dxg070.
  10. Choi JW, Lee SY, Choi Y. Identification of a putative G protein-coupled receptor induced during activation-induced apoptosis of T cells. Cell Immunol1996; 168(1): 78-84. doi: 10.1006/cimm.1996.0051.
  11. Mandel M, Gurevich M, Pauzner R, Kaminski N, Achiron A. Autoimmunity gene expression portrait: specific signature that intersects or differentiates between multiple sclerosis and systemic lupus erythematosus. Clinical and Experimental Immunology2004; 138(1): 164-70. doi: 10.1111/j.1365-2249. 2004.02587.x.
  12. Longmire JL, Albright KL, Lewis AK, Meincke LJ, Hildebrand CE. A rapid and simple method for the isolation of high molecular weight cellular and chromosome-specific DNA in solution without the use of organic solvents. Nucleic Acids Research1987; 15(2): 859. doi: 10.1093/nar/ 15.2.859.
  13. Ye S, Dhillon S, Ke X, Collins AR, Day INM. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Research2001; 29(17): e88-e88. doi: 10.1093/nar/29.17.e88.
  14. Bengtsson AA, Rylander L, Hagmar L, Nived O, Sturfelt G. Risk factors for developing systemic lupus erythematosus: a case-control study in southern Sweden. Rheumatology 2002; 41(5):563-71. doi: 10.1093/ rheumatology/41.5.563.
  15. Borchers AT, Naguwa SM, Shoenfeld Y, Gershwin ME. The geoepidemiology of systemic lupus erythematosus. Autoimmun Rev2010; 9(5): A277-87. doi: 10.1016/j.autrev.2009.12.008.
  16. Cooper GS, Wither J, Bernatsky S, Claudio JO, Clarke A, Rioux JD. et al. Occupational and environmental exposures and risk of systemic lupus erythematosus: silica, sunlight, solvents. Rheumatology 2010; 49(11): 2172-80. doi: 10.1093/rheumatology/keq214.
  17. Barbhaiya M, Costenbader KH. Ultraviolet radiation and systemic lupus erythematosus. Lupus2014; 23(6): 588-95. doi: 10. 1177/0961203314530488.
  18. Kyaw H, Zeng Z, Su K, Fan P, Shell BK, Carter KC. et al. Cloning, characterization, and mapping of human homolog of mouse T-cell death-associated gene. DNA Cell Biol1998; 17(6): 493-500. doi: 10.1089/dna.1998. 17.493.
  19. Cham CM, Driessens G, O'Keefe JP, Gajewski TF. Glucose deprivation inhibits multiple key gene expression events and effector functions in CD8+ T cells. Eur J Immunol2008; 38(9):2438-50. doi: 10.1002/eji. 200838289.
  20. Wirasinha RCSSVsHFoMU: The role of GPR65 in T cell function and demyelinating autoimmune disease. In. Edited by Batten MCSSVsHFoMU, Brink RCSSVsHFoMU; 2015.
  21. Franke A, McGovern DPB, Barrett JC, Wang K, Radford-Smith GL, Ahmad T. et al. Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. Nat Genet2010; 42(12): 1118-25.
  22. Ke X. Presence of Multiple Independent Effects in Risk Loci of Common Complex Human Diseases. American Journal of Human Genetics2012; 91(1): 185-92. doi: 10.1016/j.ajhg.2012. 05.020.
  23. Chua KH, Kee BP, Tan SY, Lian LH. Interleukin-6 promoter polymorphisms (-174 G/C) in Malaysian patients with systemic lupus erythematosus. Braz J Med Biol Res2009; 42(6): 551-5. doi: 10.1590/s0100-879x20090006000 12.
  24. Jacob N, Stohl W. Cytokine disturbances in systemic lupus erythematosus. Arthritis Res Ther2011; 13(4): 228. doi: 10. 1186/ar3349.
25. Liu P, Song J, Su H, Li L, Lu N, Yang R, et al. IL-10 Gene Polymorphisms and Susceptibility to Systemic Lupus Erythematosus: A Meta-Analysis. PLoS ONE2013; 8(7): e69547. doi: 10.1371/journal.pone. 0069547.